Text (abstrak)

Download (133kB) | Preview
[img] Text (full text)
PDF TESIS TITIEK 2017 OK compressed.pdf
Restricted to Registered users only until 2 November 2020.

Download (2MB)


Mycobacterium tuberculosis adalah penyebab penyakit Tuberkulosis (TB) yang patogen infeksius dengan angka morbiditas dan mortalitas yang signifikan. Tantangan saat ini adalah peningkatan kasus TB Multiple Drug Resistant (MDR). Pirazinamid (PZA) merupakan obat anti TB untuk pengobatan Mycobacterium tuberculosis non resisten maupun resisten. PZA bersifat bakterisidal dan aktif membunuh organisme intraseluler. Pemeriksaan akurat dan cepat untuk menentukan resistensi PZA secara fenotipik sulit dilakukan karena membutuhkan suasana asam untuk mengaktifkan PZA, tetapi akan membuat Mycobacterium tuberculosis sulit tumbuh dan mati. Mutasi gen pncA dipertimbangkan sebagai penyebab utama resistensi PZA pada Mycobacterium tuberculosis. Tujuan penelitian ini untuk menentukan karakterisasi serta korelasi mutasi gen pncA dengan resistensi PZA pada isolat klinik Mycobacterium tuberculosis MDR. Metode: Total 35 isolat klinik Mycobacterium tuberkulosis dilakukan uji sensitivitas terhadap PZA dengan BACTEC MGIT 960 (Becton Dickinson Microbiology Systems, Sparks, Md.). Isolat tersebut diekstraksi, diamplifikasi dengan PCR, dan dilakukan sekuensing pada gen target pncA. Analisis dilakukan untuk menentukan mutasi gen pncA dibandingkan dengan isolat kontrol Mycobacterium tuberkulosis H37Rv. Hasil: Total 35 isolat klinik Mycobacterium tuberculosis MDR didapatkan 22 isolat (62,86%) resisten dan 13 isolat (37,14%) sensitif terhadap PZA dengan BACTEC MGIT 960 sebagai pemeriksaan baku emas. Mutasi gen pncA didapatkan pada 13 isolat (59,09%) yang resisten PZA dan 1 isolat (7,69%) yang sensitif PZA. Analisis korelasi mutasi gen pncA terhadap resistensi PZA dari isolat klinis Mycobacterium tuberculosis MDR bermakna (p=0,003 dan r=0,452). Proporsi mutasi pada 3 (tiga) regio spesifik gen pncA (kodon 51- 76, 130-142, dan 163-180) dengan resistensi PZA adalah 18,2%. Jenis mutasi yang terjadi pada gen pncA isolat klinik Mycobacterium tuberculosis MDR antara lain substitusi (85,72%), insersi (14,28%), dan delesi (0%). Mutasi penelitian ini yang belum pernah ditemukan adalah insersi 178 CGCGCTGGAGGAGATGCGCACCGCC dan mutasi beberapa nukleotida pada satu isolat yaitu Thr135Ser, Asp136Glu, Ala146Ala, Arg148Leu, Ala152Ala, Arg154Met, Ala170Asp, Leu172Met, Glu174Asp, Ala178Asp, Glu181stop. Kesimpulan: Proporsi resistensi PZA pada isolat klinik Mycobacterium tuberculosis MDR cukup tinggi. Korelasi mutasi gen pncA terhadap resistensi PZA dari isolat klinis Mycobacterium tuberculosis MDR mempunyai tingkat hubungan yang sedang. Pemeriksaan uji sensitivitas secara fenotipik diperlukan untuk deteksi resistensi PZA. Pemeriksaan cepat molekuler dapat digunakan untuk pertimbangan manajemen terapi pasien infeksi TB MDR di Indonesia

Item Type: Thesis (Thesis)
Additional Information: KKA KK TKKli.11/17 Sul k
Uncontrolled Keywords: resistensi PZA, mutasi gen pncA, TB MDR
Subjects: R Medicine
Divisions: 01. Fakultas Kedokteran
TITIEK SULISTYOWATI, NIM011328226306NIM011328226306
Thesis advisorNi Made Mertaniasih, Prof. Dr., dr., MS., Sp. MK (K)UNSPECIFIED
Depositing User: Unnamed user with email indah.fatma@staf.unair.ac.id
Date Deposited: 01 Nov 2017 22:20
Last Modified: 01 Nov 2017 22:20
URI: http://repository.unair.ac.id/id/eprint/65547
Sosial Share:

Actions (login required)

View Item View Item