DETECTION OF yaiO GENE IN Escherichia coli FROM LAYER CHICKEN ISOLATE IN JABON SIOARJO BY POLYMERASE CHAIN REACTION

LARAS RETNO KINASIH HARIANTO, 061411131096 (2018) DETECTION OF yaiO GENE IN Escherichia coli FROM LAYER CHICKEN ISOLATE IN JABON SIOARJO BY POLYMERASE CHAIN REACTION. Skripsi thesis, Universitas Airlangga.

[img] Text (abstrak)
KH.240-18 Har d abstrak.pdf

Download (126kB)
[img] Text (fulltext)
KH.240-18 Har d.pdf
Restricted to Registered users only until 9 January 2022.

Download (1MB) | Request a copy
Official URL: http://lib.unair.ac.id

Abstract

The aims of this research were to isolate Escherichia coli from layer chicken, found yaiO gene in Escherichia coli and to see the homology of the yaiO gene compared to data base in NCBI from layer chicken in Kedung Pandan, Jabon, Sidoarjo. The methods used in this research were isolation using EMBA and identifying bacteria using biochemical test such as SIM, SCA, Urea, TSIA and sugars test, PCR method with sequence primer of yaiO-F 5′ TGATTTCCGTGCGTCTGAATG 3′ and yaiO-R 5′ ATGCTGCCGTAGCGTGTTTC 3′, and the last sequencing method. The results showed that metallic green colony from isolated bacteria in EMBA, and biochemical result showed SCA (-), SIM (indol (+) and motile), Urea (-), TSIA (A/A, H2S (-), gas (+)), sugar test: Maltose (+), Lactose (+), Mannitol (+), Glucose(+) and Sucrose (+). It can be concluded that the isolated bacteria was Escherichia coli positive. The isolated Escherichia coli had indicated the presence of bands of PCR results indicating that the bacteria were positive for the yaiO gene. The sequence results shown that the bacteria had 96% of homological to data bases in NCBI.

Item Type: Thesis (Skripsi)
Additional Information: KKC KK KH.240/18 Har d
Uncontrolled Keywords: Escherichia coli, PCR, yaiO, Layer Chicken.
Subjects: S Agriculture > SF Animal culture > SF600-1100 Veterinary medicine
Divisions: 06. Fakultas Kedokteran Hewan
Creators:
CreatorsNIM/NIDN
LARAS RETNO KINASIH HARIANTO, 061411131096UNSPECIFIED
Contributors:
ContributionNameNIDN/NIDK/NUP
ContributorSri Agus Sudjarwo, Prof. , Drh., Ph.DUNSPECIFIED
Depositing User: Unnamed user with email nafisa@lib.unair.ac.id
Date Deposited: 09 Jan 2019 04:53
Last Modified: 09 Jan 2019 04:53
URI: http://repository.unair.ac.id/id/eprint/78021
Sosial Share:

Actions (login required)

View Item View Item