Lestari Wilujeng and Gunanti Mahasri and Mufasirin (2014) Keragaman Gen Cytochrome B Pada Sidat (Angulia bicolor) Berdasarkan Restriction Pragment Length Polymorphism (RFLP). Jurnal Ilmiah Perikanan Dan Kelautan, 6 (2). pp. 117-123. ISSN 2085-5842, e-ISSN 2528-0759
|
Text (Jurnal)
Bukti C 08 KERAGAMAN GEN CYTOCHROME .....pdf Download (2MB) |
|
|
Text (Peer Review)
Peer review C 08.pdf Download (2MB) |
Abstract
This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 '). PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %. Keywords : Cytochrome b, Anguila bicolor, RFLP-mtDNA
| Item Type: | Article | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Uncontrolled Keywords: | Cytochrome b, Anguila bicolor, RFLP-mtDNA | ||||||||
| Subjects: | S Agriculture > SF Animal culture > SF600-1100 Veterinary medicine S Agriculture > SF Animal culture > SF600-1100 Veterinary medicine > SF811-909 Veterinary medicine of special organs, regions, and systems |
||||||||
| Divisions: | 06. Fakultas Kedokteran Hewan > Parasitologi Veteriner | ||||||||
| Creators: |
|
||||||||
| Depositing User: | Nn Erna Dwi Indriyani | ||||||||
| Date Deposited: | 20 Apr 2020 04:50 | ||||||||
| Last Modified: | 20 Apr 2020 04:50 | ||||||||
| URI: | http://repository.unair.ac.id/id/eprint/95104 | ||||||||
| Sosial Share: | |||||||||
Actions (login required)
![]() |
View Item |


